BUDDIES

Auronoi-Cheifton's 680 BUDDIES:
No computer— will be back in a year or so~
Publishing some older stuff. Don't hate.:-)
Downrating doesn't increase your creator skills :)
‎ur brtty gud snek ( ͡° ͜ʖ ͡°) https://youtu.be/2z
It's not what you think it is.
Populating the galaxy one nightmare at a time.
Opposable thumbs is where trouble first started!!
Void begets entropy. Existance is resistance.
Why defy what has already come to pass?
Norihika
Boldly Going
back in business! YEAH~!
99 quailty building created wait for the 100th
Spore is tha Sh*t
Downrating this creatures? OK 8D
Alex Aensland
Spore: mass mediocrity/rare talent
Conquering the universe, one cell at a time
Your memory will carry on, we'll carry on
I do not like the demo version ... But without opt
Pissin blimey! Theres jam coming outta the walls!
getting back into the swing of things
Cuteness is a survival trait.
- the beast master
Checking in for the nostalgia...
new creations now at my youtube page
Aka Lolth
I'm BAAAAAAaaaaaaack.
The world only makes sense when you force it to.
Claws as thin as Diamond twine.
Poop it out.
Your only limited by how crazy your not
Cry Havoc! and unleash the spores of war!
Recreating the gaming world one entity at a time!
Every Girl Should Have a Unicorn
Real Creatures, No Objects!
May the great biengs shine upon you.
I do KSP now. Check me out on reddit :)
l( ^o^)/
http://stepstotrespassing.yolasite.com
Occasional maker of wallpapers on deviantArt
A relic from a glorious time.
Are you Magic? If not play my Magic series.
Down and out for the count
change your tagline
Check out the Excalibur story on BTN!
Spore unlocks the imagination.
is trying to make some cool stuff, a lil busy tho
I don't do much around here....
on and off,and on again.
I reject your reality, and substitute my own.
Play, enjoy, don't downrate because you're jealous
maxis, make sum new shit already.
Shadowforge Industries - Building Tomorrow
Working on various projects, allways around though
Everything free use . . .
taking a break from spore for a while
With the shield or over the shield...
*Time slipping on galactic medieval era Now*
If you got the money, honey, we got your disease
change your tagline
Hard setting is the only setting.
The true genius relies upon their imagination.
EA stinks.
Feel free to use any and all my creations.
Ugh, Sorry about being offline. Portfolio work. Dx
Less creations after the great culling
It's been nice, Spore. Maybe in another life.
OK I swear this is getting a bit weird
Creations for Play, Subscribe say Hi :)
computer want let me play any more.
MMWWTOTW
Just trying not to fall on my face.
Very busy at school. I'll be back soon.
stop drop and rofl!
What lies above or way beyond?
On a break from Spore.
何とか、ウルトラ怪獣クリーチャー作成を続けています。
I'm taking a break, thanks to all who supported me
Busy with college I'll try to keep creating
I have DA: http://myrmoorzai.deviantart.com/
The Chaos Queen's creeping creations!
change your tagline
Ain't got time to lose my groove
If you don't think it's possible, try it anyway.
TMNT and Star Trek forever!
Still waiting for a Spore 2...
Prehistory in the making!
Peace if possible, truth at all costs
Wooo! made a new adventure XD
Creativity is a form of Madness...
I'm back and making creations once again. :D
Heroics all the same.
believing in creative genius, one spore at a time!
Propmaster is still alive, still alive
Zath...Return...
Art for art's sake.
All props are free to use
Feel free to rate the creations!
Resserecting the Past...One Dinosaur at a Time.
I've switched to my alt Revodar. Look me up there!
Whatever...
2024
It's all or nothing there is no in between
If you copy/modify please remember to give credit
Simplicity is the ultimate sophistication.
Novus Ordo Seclorum!
Rinky Dink Cartoonist
Dare not meddle within the affairs of we dragons!
Win 10 and Spore do not quite match...
Bye, and thank you for coming to my page.
So many games so little time
Stopped with Spore. (look latest creation)
9 × 46.0 cm (18.1 in)
Strike while the iron is hot!
All about the spaceships
wants some ideas about what to make next...
Illars demand a sacrifice.
Slightly less intelligent than a rock.
Hello ^.^ . Just a bunch of random creatures.
Who needs a universe when you can create your own?
The Dragonoid Avenger
Where are my bot parts?
Dragon
Not comin' back. New account: xX_japan_Xx.SUB MEH!
All the Realms and Worlds...
https://mobile.twitter.com/drakuhound1997
Daily Pot- and Pan-Beating
sanity is for the weak
DeviantART: SessaV
Jakster is my husband and we watch tv all night
Demented but Determined
http://emmamarieward.deviantart.com/
Nope, I'm out.
Predicting the new starters years ago
fiction has to be plausible. reality does not.
-DaLittlePanda-
Just approved comments dating back to 2011. MIAa
Name: Henning / Gender: male / Country: Germany
go with the flow
No longer at the mercy of the Reptile brain.
You! Out of the gene pool!
A line is a dot that went for a walk.
As real as it gets!
http://creativewilds.deviantart.com/
Aran Suit Manufacturing
On temporary hiatus for work.
AVP
I click ergo I am!
Where did some of my stuff go?!
Vive la Evolution
Anime freak! I love Vocaloid and Zero no Tsukaima!
VIGM, Vereinigung Intergalaktischer Milchbauern
Channel dead forever
Occasionally posting creations
Expand my universe!
Havin loads of fun creating creatures with my kids
1452374958012461510134357134963838771901064293
Check out my instagram @ Livamoah
Same person as Hellhole1026
Making a Come Back
JUST, SURFIN' WITH THE ALIEN....
In Soviet Serbia, kebab removes you.
The universe awaits
GOD IS DEAD
Don't even worry about it!
Evolution is God's little inside joke.
Ambrosia is Marshmallow Fluff
Back for the creativity boost
demented perfectionist
The Magma-born shall rise!
Out Of The Office. Use what you want!
change your tagline
oh this silly dead site
May the force be with you!
Dragons FTW!
Light up the Fire - Ride on the Power!
Can't change my profile pic.
I'm still around, my new profile is Coffeeegazer.
Enslave First, Ask Later.
On vacation.
Don't create for comments. Create for fun
Wherever you go, there you are
myu?
why do people still care about this game?
Well hello there.
A world in a grain of sand, a life lost to a game.
SNS Serious Noise Shipworks
Please use any of my creations if you wish
Feeling creative all of the sudden!
(∩ ͡° ͜ʖ ͡°)⊃━☆゚. * ・ 。゚
GA maker 5.7
boy howdy why is spore still alive
Off and on, creating
I'm Hunter.I'll hunt for you!
with exparamentation comes an awesome Creation
Yōkai-preternatural creatures in Japanese folklore
Take it easy no stress
Old spore <3
MPN looks trash.
KOM T MOSH
Story of a Drama Queen: the rise and fall
In space only the monster hears you scream.
dovie'andi se tovya sagain
Still alive :)
The best creations come once you run out of ideas.
Its contest time, comment for details
Why is Spore so addictive...? *Puts heroine away*
www.maninthedark.com/
Drew is my husband and we watch tv all night
still mostly away but do check in when can
Still around to respond to comments!
Currently on haitus (sorry).
Gentlemenne.
I haz a snout! :3
Hark to the story!
I'm back!!!
no comments please. backed up and nothing new
I am unlucky. Therefore, I am lucky.
now has a netbook and starts a comeback! :D
Getting Bored of Spore
In duty for spore
Switched to Decapitron13
Sanity is overrated.
Superman's freeloading older brother
Have you tried Blender yet?
1/17/25: am dead?
Takin' a break from spore for a while.
Full of :D!
I am a rose whose thorns are hidden by leaves.
ACCOUNT VACANT - go to Rainmask (1/29/16)
Still alive!
All Hail Cheese
You can't fit an entire sun into a planet.
We can't stop here... this is bat country.
Mors Regis
Reminiscing..
legacy acc
Creativity, patience, Spore and a computer.
Minerva Shipyards Incorporated
I'm back!
Lead tenor sax for Kroc Center jazz ensemble
Suck my dick
Lord by your side. EAW & Sporenaissance!
Be back soon folks - dont cry...to much ;p
has left the building
trying to regain my edge
Is a Jesus Freak
You're gonna have a bad time
dont mess with da 8 ball
My entire page is a work in progress.
Grandmaster of delusion and confusion! ..or not?
Hey whats this button do?
Busy making world domination plans...
Busy with my writing, happy Sporing!
Mexicano de Corazon
Back for more Spore! (I missed you, Spore!)
Don't Worry EXCALlBUR ;) I'll come back soon!
two years away from spore...
Space Cat is not a crime
A complete fool
Let's build up something~! ♥
You never know where you stand with a cactus.
:D Patapon3
Skype: Darius4464 (meekotaadl@gmail.com)
Epitome of Procrastination
change your tagline
I'm on and off, I don't care!!!!!!!!!!
Pinky and the Brain in one person
The randomness is strong with this one.
Y'all must've really missed me! I appreciate it~
I'll be back...
changed the tagline
Very very busy...I'm so sorry.
the freaky and the cool live here
Well, I'm gone. Bye everyone =^w^=
monstercreater12
WHATS WITH ALL THE GROX?
Try to make your stuff look good AND animate good!
Street walking cheetah with a heart full of napalm
Gone, gone, gone.
... and only I shall remain.
I'm back!
"The truth is often stupid." -- Bender
Retired.
Halo 4, Halo CEA, Bf3 and a bit of Spore, what mor
To genius and idiots, and gods in everyone of us.
GAprops and templates
Creating on Draacen.
Just Got GA :D
You're not the big fish in the pond anymore, mate.
Spore is a extraordinary game !=D
I'm just a luuurrrve machine!!
Thanks and goodbye to all my buddies.
Overlord of all Ninjas
done with spore, feel free to use my creatures
The Undead Lord
Massive creativity block... no good creations...
a.k.a. EgoNaut
I'm just a mean green mother, from outer space!
Not dead; just practicing.
I am nowhere,everywhere.
Full speed ahead and damn the consequences!
Please wait while tagline is loading...
quiting spore for a while
Gone for good. Everyone here needs to grow up.
Ready to create
Try to be there but no connections to share around
very unactive atm
Don't you remember when spore was so...mysterious?
a bit out of practice
new account: Bamfasaurus :)
the end. maybe.
No opinion.
Possiblilty is limited to imagination.
Invincibility lies in defense
Sic Transit gloria Mundi
In space, no one can hear you scream...
I'm in this for the long run guys...
KYA! HA! HA! HA! HA! HA!
This automatic creation upload is bugging me.
lol featured creation list hasn't changed. ever
Hey team-- Am on hiatus. Exams. o.o
Deus pascit corvos
In hibernation
All shall fall to the Void.
Around sparingly
Lots of good, but also some bad too (old ones)
Long Live The USK
Join the dark side... and get a free cookie.
Takin' a break, buildin' a sentry
Let's go again
drop me a comment if you like my stuff
http://www.youtube.com/user/DarkEdgeTV
I make my own friends!
Hosting the SPOSCARS in the adventure section!
The Klown Prince of Creation
http://www.youtube.com/user/Hipponotapus/videos
Currently doing a research essay on Spore!
Paranoid and Proud
Back in business
Webmiss of SporeNetwork.com
much less active now :(
Sorry about the lack of activity; I'm pretty busy.
Living in my own little world; You're invited
Imagination Is What Makes Us Human...
Probably wont be on regularly but who knows 😎
Hang on, just wait whilst I distribute metaphyta!
Hello world
Return as Alt
There's a starman waiting in the sky.
Sorry for my prolonged absence. Back in June.
60 Subs! Thank you guys!
H̴̪͍̪̞̝̠͙̬̫̻̮̻ͧͭͤ̉́͢͞Ë̙͍̳̤̺̭̄ͪ̔ͨ̅̇̏̎̈́͑͋ͤͭ͘͟Y̢͛̓͂͑
Creations should look good & function in game!
I LIVED! :D
will be back to spore shortly..
Answering comments. Will take a wile ;)
is Probably doing something chaotic with Team RWBY
GO GET LBP2 NOW.
Creating is my way of telling you a story.
Moved on, may return for expac
What do you Believe?
There are still so many good creators around...
change your tagline
never really liked this name, now I'm PlasmaFire
Coming soon: Xenoplanet Ytterb-3
how to make contest
Anthros and dragons!
long time no spore!
change your tagline
I reject your reality and substitute my own.
I suffer from Temporal Fanatica
Sorry I haven't been on lately, but im a bit busy.
Doing okay. Mechs are neato.
tagtagtagtagtagtagtagtagtagtag
The selfish geneticist
open wound to be mended soon.
No longer play Spore. Working hard now.
Mit oder auf dem Schild
building the finest hunks of junk in the galaxy
check out my blog: http://dreamdiary-becominglucid
I am infected by the Epidemic... And I like it...
School is keeping me busy. Sorry :(
What happens when my dreams become Spore...
My new profile is called Metamorphoid! Please sub
How do you spore?
I am DandLProductions.
They COULD excist...
Call me when Spore gets patched..
Pucker up, buttercup.
Wanna dance?
Tagline Smagline
Long Live Spore
owls and vinegar
Spore community really sank, didn't it? See ya!
In need of an active vehicle Forum
A storm of metal
So... who's up for round 2? For old times sake?
Current status: OFFLINE
Making what I make best.
Creating on Draacen.
Ships don't build themselves.
All Your Side Projects... Are Belong To Us
I am Thobewill
Clever enough?
Rebooting... Pls stand by for creations
Going where none have gone before!
Miss this game :(
I still miss the old Sporum :(
Should I be a soldier for Halloween?
Busy with real life, not sure when I'll be back
Installing Spore on new pc, bbs ;)
Call of duty NOKIA
TonyG of the Drag-Spid-Spion Empire.
Nothing Lasts Forever
Back in 2023 baby!
Doing things randomly since 1994.
vive moi
~Excuuuuuse me~, princess!
Ich bin halt ein Deutscher
What is the Tuna Matrix?
Moved to Twarda8; got another SPORE (@Twarda8)
Retired. Disect, repaint, reuse, all good.
its broken again......='[
Uninstall ALL the spores!
I still check up on you guys! :P
Thanks for all the comments :]
Vegetatious Creations: Fine Creations Since 2008
Howdy hOWDY howdee!
i'm back nerds, expect some adventures soon maybe
Imagine
Tea is good for you!
Ippen shinde miru?
Enforced Equilibrium
trying hard to make something good
Xeno spitter
Beware of the Space Ducks!
get some
knowledge is power, guard it well
anything you can imagine is out there ,- somewhere
My DA- mechformer93.deviantart.com
Thats awsome!
Hey there ;)
10 Years of Quackenstein
Where did he go?
your talking about nothing
change your tagline
the bots pack was a b@%*& to get
thank you mister darwin
https://mkremins.github.io
change your tagline
Comment and Rate Or else kittens will explode.
computer has been fixed :)
Okay, who lit my underwear on fire??
Short, armless, no depth perception. Life is hard.
Godzilla is king
2018: BACK IN
Back for more!
Has left his mark on the community.
Did I was banned?
Kaiser of all things.
knowledge is limited, Imagination isn't
Featured Spaceship Creator